The EcoRI restriction site is 5’ GAATTC 3’. At a particular gene locus, you observe the following wild-type and mutant allele sequences: WT: 5’ CAATTGAATGTCGCGTGTATTCGACTGGTAG 3’ MU: 5’ CAATTGAATTCGCGTGTATTCGACTGGTAGG 3’ What result would you expect from RFLP analysis of this SNP?

0 votes

 

  

The WT allele would show one band, while the mutant would have two bands.

  

The WT allele would show two bands, while the mutant would have three bands.

  

The WT allele and mutant allele would both show two bands because the enzyme cuts twice.

  

The WT allele would show three bands, while the mutant would have two bands.

 

asked May 16, 2013 in Genetics by GeneX ~Top Expert~ (7,947 points)
    

1 Answer

0 votes
 
Best answer
The WT allele would show two bands, while the mutant would have three bands.
answered May 16, 2013 by GeneX ~Top Expert~ (7,947 points)

Related questions




...