What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5’ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3’?

0 votes

 

  

nine

  

seven

  

10

  

six

 

asked Dec 27, 2012 in Biology by anonymous
    

1 Answer

0 votes
six
answered Dec 27, 2012 by anonymous

Related questions




...