What is the amino acid sequence of the polypeptide produced from this mRNA?

0 votes

A eukaryotic mRNA has the following sequence. The 5' cap is indicated in italics (CAP), and the 3' poly(A) tail is indicated by italicized adenines. 

5'-CAP CCAAGCGUUACAUGAGUACCGCGGAUUAUAUAAGCUUCGCAAAUACUGCCUCUUA

GGCACCUAUGCUACCAAAAAAAAAAAAAAAAAAAAAAAA-3'

 
Determine the amino acid sequence of the polypeptide produced from this mRNA.
asked Nov 18, 2013 in Genetics by AzzidReign (60 points)
    

Please log in or register to answer this question.

Related questions

0 votes
1 answer 54 views



...